Cusabio Medical Devices

Lab Reagents

Cusabio Laboratories manufactures the cusabio medical devices reagents distributed by Genprice. The Cusabio Medical Devices reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Cusabio. Other Cusabio products are available in stock. Specificity: Cusabio Category: Medical Group: Devices

Devices information

17-Hydroxyprogesterone Antibody, 13ML

C190-13ML 13ML
EUR 1059

PALMD cloning plasmid

CSB-CL017416HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1656
  • Sequence: atggaagaagctgagctggtgaagggaagactccaggccatcacagataaaagaaaaatacaggaagaaatctcacagaagcgtctgaaaatagaggaagacaaactaaagcaccagcatttgaagaaaaaggccttgagggagaaatggcttctagatggaatcagcagcggaa
  • Show more
Description: A cloning plasmid for the PALMD gene.

PAM cloning plasmid

CSB-CL017417HU-10ug 10ug
EUR 838
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2601
  • Sequence: atggctggccgcgtccctagcctgctagttctccttgtttttccaagcagctgtttggctttccgaagcccactttctgtctttaagaggtttaaagaaactaccagaccattttccaatgaatgtcttggtaccaccagacccgtagttcctattgattcatcagattttgcat
  • Show more
Description: A cloning plasmid for the PAM gene.

PANK1 cloning plasmid

CSB-CL017421HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 414
  • Sequence: atggcagctaaaggcgacagcaccaatgttgataaactggtgaaggacatttacggaggagactatgaacgatttggccttcaaggatctgctgtagcatcaagctttggcaacatgatgagtaaagaaaagcgagattccatcagcaaggaagacctcgcccgggccacattggt
  • Show more
Description: A cloning plasmid for the PANK1 gene.

PAPLN cloning plasmid

CSB-CL017431HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 390
  • Sequence: atgcggctgctcctgctcgtgccgctgctgctggctccagcgcccgggtcctcggctcccaaggtgaggcggcagagtgacacctggggaccctggagccagtggagcccctgcagccggacctgtggagggggtgtcagcttccgggagcgcccctgctactcccagaggagaga
  • Show more
Description: A cloning plasmid for the PAPLN gene.

PAPOLA cloning plasmid

CSB-CL017432HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 858
  • Sequence: atgccgtttccagttacaacacagggatcacaacaaacacaaccgccacagaagcactatggcattacttctcctatcagcttagcagcccccaaggagactgactgcgtacttacacagaaactaattgagacattgaaaccctttggggtttttgaagaggaagaggaactgca
  • Show more
Description: A cloning plasmid for the PAPOLA gene.

PARK2 cloning plasmid

CSB-CL017451HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1164
  • Sequence: atgatagtgtttgtcaggttcaactccagccatggtttcccagtggaggtcgattctgacaccagcatcttccagctcaaggaggtggttgctaagcgacagggggttccggctgaccagttgcgtgtgattttcgcagggaaggagctgaggaatgactggactgtgcagaatt
  • Show more
Description: A cloning plasmid for the PARK2 gene.

PARN cloning plasmid

CSB-CL017456HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1920
  • Sequence: atggagataatcaggagcaattttaagagtaatcttcacaaagtgtaccaggccatagaggaggccgacttcttcgccatcgatggggagttttcaggaatcagtgatggaccttcagtctctgcattaacaaatggttttgacactccagaagagaggtatcagaagcttaaaa
  • Show more
Description: A cloning plasmid for the PARN gene.

PAX3 cloning plasmid

CSB-CL017489HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 621
  • Sequence: atgaccacgctggccggcgctgtgcccaggatgatgcggccgggcccggggcagaactacccgcgtagcgggttcccgctggaagtgtccactcccctcggccagggccgcgtcaaccagctcggcggcgtttttatcaacggcaggccgctgcccaaccacatccgccataagat
  • Show more
Description: A cloning plasmid for the PAX3 gene.

PAX3 cloning plasmid

CSB-CL017489HU2-10ug 10ug
EUR 517
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1455
  • Sequence: ATGACCACGCTGGCCGGCGCTGTGCCCAGGATGATGCGGCCGGGCCCGGGGCAGAACTACCCGCGTAGCGGGTTCCCGCTGGAAGTGTCCACTCCCCTCGGCCAGGGCCGCGTCAACCAGCTCGGCGGCGTTTTTATCAACGGCAGGCCGCTGCCCAACCACATCCGCCACAAGA
  • Show more
Description: A cloning plasmid for the PAX3 gene.

PAX4 cloning plasmid

CSB-CL017490HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 774
  • Sequence: ATGGCCTGGTCCAGTAAGTCTTGGCTTTGTCTTATAGCCTCCTCCTGTCCCAGGGACACTCTCCTTCCTTCTGCCCATCATGCCTCACCTGTCCCTGCTTCTCACCTGACTCAGGTATCTAATGGCTGTGTGAGCAAGATCCTAGGGCGTTACTACCGCACAGGTGTCTTGGAGCC
  • Show more
Description: A cloning plasmid for the PAX4 gene.

PAX6 cloning plasmid

CSB-CL017492HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1267
  • Sequence: atgcagaacagtcacagcggagtgaatcagctcggtggtgtctttgtcaacgggcggccactgccggactccacccggcagaagattgtagagctagctcacagcggggcccggccgtgcgacatttcccgaattctgcaggtgtccaacggatgtgtgagtaaaattctgggca
  • Show more
Description: A cloning plasmid for the PAX6 gene.

PAX7 cloning plasmid

CSB-CL017493HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1557
  • Sequence: ATGGCGGCCCTTCCCGGCACGGTACCGAGAATGATGCGGCCGGCTCCGGGGCAGAACTACCCCCGCACGGGATTCCCTTTGGAAGTGTCCACCCCGCTTGGCCAAGGCCGGGTCAATCAGCTGGGAGGGGTCTTCATCAATGGGCGACCCCTGCCTAACCACATCCGCCACAAGA
  • Show more
Description: A cloning plasmid for the PAX7 gene.

PAX8 cloning plasmid

CSB-CL017494HU-10ug 10ug
EUR 489
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1353
  • Sequence: atgcctcacaactccatcagatctggccatggagggctgaaccagctgggaggggcctttgtgaatggcagacctctgccggaagtggtccgccagcgcatcgtagacctggcccaccagggtgtaaggccctgcgacatctctcgccagctccgcgtcagccatggctgcgtca
  • Show more
Description: A cloning plasmid for the PAX8 gene.

PBLD cloning plasmid

CSB-CL017501HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 867
  • Sequence: atgaagcttcctattttcatagcagatgcattcacagcaagagcatttcgtgggaatcctgctgctgtttgcctcctagaaaatgaattggatgaagacatgcatcagaaaattgcaagggagatgaacctctctgaaactgcttttatccgaaaactgcacccgacagacaactt
  • Show more
Description: A cloning plasmid for the PBLD gene.

PBX2 cloning plasmid

CSB-CL017506HU1-10ug 10ug
EUR 404
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1050
  • Sequence: atggacgaacggctactggggccgccccctccaggcgggggccgggggggcctgggattggtgagtggggagcctgggggccctggcgagcctcccggtggcggagaccccggtgggggtagcgggggggtcccgggaggccgagggaagcaagacatcggggacattctgcagc
  • Show more
Description: A cloning plasmid for the PBX2 gene.

PBX2 cloning plasmid

CSB-CL017506HU2-10ug 10ug
EUR 472
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1293
  • Sequence: atggacgaacggctactggggccgccccctccaggcgggggccgggggggcctgggattggtgagtggggagcctgggggccctggcgagcctcccggtggcggagaccccggtgggggtagcgggggggtcccgggaggccgagggaagcaagacatcggggacattctgcagc
  • Show more
Description: A cloning plasmid for the PBX2 gene.